The Collagen-Based Medical Device MD-Tissue Acts as a Mechanical Scaffold Influencing Morpho-Functional Properties of Cultured Human Tenocytes

Filippo Randelli 1 , Patrizia Sartori 2 , Cristiano Carlomagno 3, Marzia Bedoni 3 ,
Alessandra Menon 2,4, Elena Vezzoli 2, Michele Sommariva 2 and Nicoletta Gagliano 2,*

1 Hip Department (CAD) Gaetano Pini—CTO Orthopedic Institute, Università degli Studi di Milano,
Piazza Cardinal Ferrari 1, 20122 Milan, Italy; filippo.randelli@fastwebnet.it
2 Department of Biomedical Sciences for Health, Università degli Studi di Milano, via Mangiagalli 31,
20133 Milan, Italy; patrizia.sartori@unimi.it (P.S.); ale.menon@me.com (A.M.); elena.vezzoli@unimi.it (E.V.);
michele.sommariva@unimi.it (M.S.)
3 IRCCS Fondazione Don Carlo Gnocchi ONLUS, via Capecelatro 66, 20148 Milan, Italy;
ccarlomagno@DONGNOCCHI.IT (C.C.); mbedoni@DONGNOCCHI.IT (M.B.)
4 U.O.C. 1 Clinica Ortopedica, ASST Centro Specialistico Ortopedico Traumatologico Gaetano Pini-CTO,
Piazza Cardinal Ferrari 1, 20122 Milan, Italy

• Correspondence: nicoletta.gagliano@unimi.it; Tel.: +39-02-50315374
  Received: 26 October 2020; Accepted: 7 December 2020; Published: 8 December 2020
  
  Abstract: Mechanotransduction is the ability of cells to translate mechanical stimuli into biochemical
  signals that can ultimately influence gene expression, cell morphology and cell fate. Tenocytes are
  responsible for tendon mechanical adaptation converting mechanical stimuli imposed during
  mechanical loading, thus aecting extracellular matrix homeostasis. Sincewepreviously demonstrated
  that MD-Tissue, an injectable collagen-based medical compound containing swine-derived collagen
  as the main component, is able to aect tenocyte properties, the aim of this study was to
  analyze whether the eects triggered by MD-Tissue were based on mechanotransduction-related
  mechanisms. For this purpose, MD-Tissue was used to coat Petri dishes and cytochalasin B
  was used to deprive tenocytes of mechanical stimulation mediated by the actin cytoskeleton.
  Cell morphology, migration, collagen turnover pathways and the expression of key mechanosensors
  were analyzed by morphological and molecular methods. Our findings confirm that MD-Tissue aects
  collagen turnover pathways and favors cell migration and show that the MD-Tissue-induced eect
  represents a mechanical input involving the mechanotransduction machinery. Overall, MD-Tissue,
  acting as a mechanical scaold, could represent an eective medical device for a novel therapeutic,
  regenerative and rehabilitative approach to favor tendon healing in tendinopathies.
  Keywords: tendon; tenocytes; tendinopathy; collagen turnover; mechanotransduction; actin cytoskeleton;
  YAP/TAZ;medical device

1. Introduction
   Tendinopathy is a chronic and painful condition aecting tendons, characterized by histological
   modifications such as hypercellularity, neovascularization, loss of collagen fibril organization,
   increased proteoglycan and glycosaminoglycan contents and increased non-collagen extracellular
   matrix components [1,2]. The therapeutic approach for tendinopathy includes rest, ice-packs,
   non-steroidal anti-inflammatory drugs (NSAIDs), physiotherapy, local corticosteroid injections or
   biological and regenerative therapies using platelet-rich plasma (PRP) or hyaluronic acid [3]. However,

treatment of tendinopathy remains a clinical unmet need, since the available treatments did not show
to have a strong ecacy and no long-term benefits were reported [2,4,5]. Therapeutic strategies are
also needed in veterinary medicine to especially treat equine tendon lesions and musculoskeletal
disorders [6–8]. MD-Tissue (MD) is an injectable collagen-based medical compound containing
swine-derived collagen as the main component. Swine collagen has high biocompatibility with human
collagen, with a very low risk of adverse eects when used in dierent medical applications, and it
was also used to prepare collagen-based skin-like scaolds [9]. Indeed, clinical studies reported that
MD-Knee, a collagen-based medical compound very similar in terms of composition to MD, is well
tolerated, and no systemic adverse events or septic complications were observed when utilized on
patients [10,11]. Therefore, MD may have the potential to be used to treat tendinopathy. Moreover,
since it can be utilized alone or in association with other therapeutic agents, and the lower cost
compared to hyaluronic acid could favor its wider use, it may oer some advantages compared to
other biological agents.
Tenocytes are specialized fibroblasts in tendon connective tissue, responsible for tendon
extracellular matrix (ECM) remodeling by influencing the turnover pathways of type I collagen
(COL-I), the main component of tendon ECM [12–14]. Tendons are interposed between muscles and
bones and transfer forces generated by muscle contraction to the skeleton. Mechanical forces acting on
tendons influence their metabolic activity and the expression of genes and proteins involved in ECM
remodeling of tenocytes that play key roles acting as mechanosensors [13,15,16].
Mechanotransduction is the ability of cells to translate mechanical stimuli into biochemical signals
that can ultimately influence gene expression, cell morphology and cell fate. Mechanotransduction
allows cells to respond to external forces and to interpret the mechanical characteristics of the
ECM. In this way, tenocytes can timely adapt to the continuous dynamic modifications of the ECM
by remodeling it [17,18]. Recently, we analyzed the in vitro eect of MD on human tenocytes [19].
We focused our attention on collagen turnover pathways, in order to describe the molecular mechanisms
triggered by this medical compound and to understand how it can aect tenocytes’ biological properties
to favor tendon homeostasis and repair [19]. In fact, in that study, we reported that MD was able
to stimulate COL-I biosynthesis, secretion and maturation and to induce tenocyte proliferation and
migration. Since tenocytes act as mechanosensors and it was demonstrated that MD is able to aect
collagen turnover pathways and cell migration, the aim of this study was to analyze whether the eects
triggered by MD were based on mechanotransduction-related mechanisms.

2. Materials and Methods
   2.1. Samples
   Fragments from the human Gluteus Minimus tendon were obtained from 4 patients (mean age
   62.25  4.57 years, 2 males and 2 females) undergoing total hip replacement through an anterior
   approach but without any gluteal tendon pathology (Figure 1). Patients diagnosed with great trochanter
   tendinopathy, aected by genetic collagen disorders, or patients diagnosed with spondyloarthritis
   with involvement of the aected hip or aected by psoriatic arthritis were excluded from the study,
   as well as drug- and alcohol-addicted patients, pregnant or breastfeeding women and patients aected
   by diabetes mellitus or who had taken fluoroquinolones within 30 days before the surgery.

For each collected tendon, the mid-substance, the region with the typical structure of the dense
regular connective tissue, was isolated and analyzed.
All subjects gave their informed consent for inclusion in the study. The study was conducted
in accordance with the Declaration of Helsinki, and the protocol was approved by the local ethics
committee (San Raaele Hospital Ethical Committee, Milan, Italy) of the coordinating institution
(IRCCS Policlinico San Donato, Milan, Italy) (63/INT/2017).
2.2. Cell Cultures
Tendon fragments were collected and immediately washed in sterile PBS. They were plated in T25
flasks and incubated in Dulbecco’s Modified Eagle Medium (DMEM) (Euroclone, Pero, Milan, Italy)
supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Gibco, Life Technologies, Monza,
Italy) and antibiotics (100 U/mL penicillin, 0.1 mg/mL streptomycin) (Euroclone), at 37 C in a
humidified atmosphere containing 5% CO2. When tenocytes grew out from the explant, they were
harvested and subcultured in T75 flasks. Human tenocytes derived for each subject were cultured in
duplicate. For morphological, functional and molecular evaluations, confluent tenocytes were cultured
in 6-well multi-well plates at the fifth passage, adding ascorbic acid (200 M) to DMEM to preserve
collagen synthesis, and harvested after 48 h. A diagram summarizing the experimental design of the
study is shown in Figure 2.
2.3. Coating with MD-Tissue or Collagen
MD (100 g/2 mL ampoules) and collagen (COL) were kindly provided by Guna (Milan, Italy).
COL is the collagen of swine origin, the principal constituent of MD, that also contains ascorbic acid,
magnesium gluconate, pyridoxin hydrochloride, riboflavin, thiamine hydrochloride, NaCl and water
as excipients. MD or COL (50 g/mL) were used to obtain a thin coating on 6-well multi-well plates
as previously described [19]. After an incubation of at least 3–4 h at room temperature to obtain
collagen adhesion to the plastic, excess fluid was removed from the coated surface and the multi-well
plate was dried under the laminar flux hood. Coated plastic was immediately used or stored at 4 C.
Cells cultured on MD-Tissue or COL were compared with cells grown on uncoated cell culture plastic,
used as untreated controls (CT).
2.4. Cytochalasin Administration
To understand if MD exerts its eect on tenocytes by a mechanical stimulation, cells were treated
with 10 M cytochalasin B (CyB) (Santa Cruz Biotechnology, Heidelberg, Germany) which inhibits
actin filaments polymerization. The dose of CyB used to treat tenocytes was chosen according to
the literature [20]. Moreover, dierent doses were tested to evaluate the possible microfilament
modifications leading to cytoskeleton injury.
2.5. Scanning Electron Microscopy
The coating containing MD and COL was observed with a scanning electron microscope (SEM)
to detect the presence of collagen fibrils/fibers and their alignment. For this purpose, the samples
were fixed with 2% glutaraldehyde and 2% paraformaldehyde buered with 0.1 M sodium cacodylate
(pH 7.3) for 1 h at room temperature. After fixation, they were rinsed three times with 0.2 M sodium
cacodylate buer (pH 7.3) for 10 min and post-fixed with 1% osmium tetroxide (OsO4) in the same
buer for 1 h on ice. Samples were rinsed twice with bi-distilled water and gradually dehydrated by
consecutive 10-min incubations in 20%, 30%, 40%, 50%, 70%, 80%, 90% and 100% ethanol, followed by
chemical drying with 50% (v/v) ethanol-hexamethyldisilazane (HMDS) and 100% HMDS that was
air-dried overnight at room temperature. All the reagents were purchased from Electron Microscopy
Sciences (Hatfield, PA, USA). Before SEM imaging, samples were mounted on 12-mm specimen stubs
using double-sided carbon tape and gold coated with a 20 nm-thick film using a Polaron E5100 sputter
coater. The SEM imaging was performed by a JEOL JSM-840A (Tokyo, Japan), operating at 15 kV and
acquiring the secondary electron signal by an Everhart-Thornley (ET) in-chamber detector.

2.6. Raman Spectroscopy
Raman spectroscopy was used to analyze the coating containing MD or COL. Raman spectra were
acquired using an Aramis Raman microscope (Horiba Jobin Yvon, France) equipped with a laser source
operating at 532 nm. All the materials were analyzed in the 400–1800 cm􀀀1 range, with a spectral
resolution of 0.8 cm􀀀1 and accumulation time of 30 s repeated on the same point for 2 accumulations.
The acquisition delay time was maintained at 2 s in order to prevent the formation of artifact spectra.
Before each analysis, the instrument was calibrated on the reference band of silicon at 520.7 cm􀀀1.
All the samples were analyzed using a line-focused map (at least 25 points) centered using 10x, 50x and
100x objectives (Olympus, Tokyo, Japan). A laser grating of 1800, with hole at 400 and slit at 200,
was used. Sample preparation was conducted depositing a 5 L drop on a Calcium Fluoride (CaFl2)
disk, dried overnight at room temperature. The data processing procedure was performed following
and adapting the protocol reported by Carlomagno et al. [21]. Briefly, all the spectra were fit with a
third-degree polynomial baseline, considering 68 baseline points, and consecutively normalized by a
unit vector. A second-degree Savitzky–Golay smoothing was applied in order to reduce noise and
non-informative spikes present in the resultant spectra. All the procedures described were performed
using the Raman integrated software LabSpec6 (Horiba Jobin Yvon, France) and Origin2018 (OriginLab,
Northampton, MA, USA).
2.7. Immunofluorescence Analysis
For fluorescence microscopy, tenocytes were cultured on 12-mm diameter round coverslips
uncoated or coated with MD or COL into 24-well culture plates, with or without CyB, as previously
described [22]. For vinculin detection, cells were incubated for 1 h at room temperature with the mouse
monoclonal antibody anti-vinculin (1:500 in PBS, clone VIN-11-5, Biotechne, Milan, Italy) and with the
secondary antibody anti-mouse/Alexa488 (1:500, Life Technologies, Carlsbad, CA, USA). In order to
analyze the actin cytoskeleton, cells were incubated with 50 M rhodamine-phalloidin (Sigma-Aldrich,
St. Louis, MO, USA).
To assess YAP/TAZ nuclear or cytoplasmic localization, cells were incubated with a rabbit
anti-YAP/TAZ antibody (D24E4, 1:400, Cell Signaling, Danvers, MA, USA) and an anti-rabbit/Alexa488
(1:500, Cell Signaling, Danvers, MA, USA).
Finally, cells on coverslips were incubated with DAPI (1:100.000, Sigma Aldrich) for 15 min and
mounted onto glass slides using Mowiol. Cells were analyzed and imaged by aWDTHUNDER Imager
Tissue 3D (Leica Microsystems CMS GmbH, Wetzlar, Germany).
2.8. Real-Time PCR
Cells were harvested and total RNA was isolated (Tri-Reagent, Sigma, Italy). One g of total
RNA was reverse-transcribed in 20 L final volume of reaction mix (Biorad, Segrate, Milan, Italy).
Gene expression for long lysyl hydroxylase 2 (LH2b), tissue inhibitor of matrix metalloproteinase
1 (TIMP-1), focal adhesion kinase (FAK) and paxillin (PAX) was analyzed by real-time RT-PCR
in samples run in triplicate. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as
endogenous control to normalize the dierences in the amount of total RNA in each sample.
The primers sequences were the following: GAPDH: sense CCCTTCATTGACCTCAACTACATG,
antisense TGGGATTTCCATTGATGACAAGC; LH2b: sense CCGGAAACATTCCAAATGCTCAG,
antisense GCCAGAGGTCATTGTTATAATGGG; TIMP-1: sense GGCTTCTGGCATCCTGTTGTTG,
antisense AAGGTGGTCTGGTTGACTTCTGG; FAK: sense GTCTGCCTTCGCTTCACG, antisense
GAATTTGTAACTGGAAGATGCAAG; and PAX: sense CAGCAGACACGCATCTCG, antisense
GAGCTGCTCCCTGTCTTCC. Each sample was analyzed in triplicate in a Bioer LineGene 9600
thermal cycler (Bioer, Hangzhou, China). The cycle threshold (Ct) was determined and gene expression
levels relative to that of GAPDH were calculated using the DCT method.
Cells 2020, 9, 2641 6 of 20
2.9. Slot Blot
Collagen type I (COL-I) and matrix metalloproteinase (MMP)-1 protein levels secreted by tenocytes
in serum-free cell supernatants were analyzed by slot blot analysis, as previously detailed [18].
Membranes were incubated for 1 h at room temperature with primary monoclonal antibodies to COL-I
(1:1000 in TBST) (Sigma-Aldrich, Milan, Italy) or MMP-1 (1 g/mL in TBST) (Millipore, Milan, Italy).
Immunoreactive bands were revealed by the Amplified Opti-4CN substrate (Amplified Opti-4CN,
Bio Rad, Segrate, Milan, Italy) and quantification was obtained after densitometric scanning of
immunoreactive bands (UVBand, Eppendorf, Italy).
2.10. Western Blot
Cells were harvested and lysed in Tris-HCl 50 mM pH 7.6, 150 mM NaCl, 1% Triton X-100, 5 mM
EDTA, 1% Sodium Dodecyl Sulphate (SDS), proteases inhibitors and 1 mM sodium orthovanadate.
After a 30-min incubation in ice, lysates were centrifuged at 14,000 g for 10 min at 4 C. Cell lysates
(15 g of total proteins) were run on 10% SDS–polyacrylamide gel, separated under reducing and
denaturing conditions at 80 V according to Laemmli and transferred at 90 V for 90 min to a nitrocellulose
membrane in 0.025 M Tris, 192 mM glycine and 20% methanol, pH 8.3. For VNC analysis, membranes
were incubated for 1 h at room temperature with the monoclonal antibody anti-VNC (1:2000) (clone
VIN-11-5, Biotechne, Milan, Italy) and, after washing, in horseradish peroxidase (HRP)-conjugated
rabbit anti-mouse antibody (1:6000 dilution, Sigma Aldrich). Immunoreactive bands were revealed
using the Opti-4CN substrate (Bio Rad).
For YAP/TAZ evaluation, membranes were incubated with the following antibodies (Cell Signaling
Technology, USA): YAP (D8H1X) XP® Rabbit mAb, p-YAP (S109) Rabbit Ab, TAZ (D3I6D) Rabbit
mAb and p-TAZ (S89) (E1X9C) Rabbit mAb. After the incubation with a horseradish peroxidase
(HRP)-conjugated goat anti-rabbit antibody (1:20000 dilution, Cell Signaling), immunoreactive bands
were revealed using the Amplified Opti-4CN (Bio Rad).
To confirm equal loading, membranes were reprobed by a monoclonal antibody to -tubulin
(1:2000 dilution, Sigma Aldrich).
2.11. SDS-Zymography
MMP-2 levels and activity were analyzed in serum-free culture supernatants (5 g of total
protein per sample) in tenocytes cultured for 48 h by SDS-zymography on 10% polyacrylamide gels
co-polymerized with 1 mg/mL type I gelatin. The gels were run at 4 C and, after SDS-PAGE, they were
washed twice in 2.5% Triton X-100 for 30 min each and incubated overnight in a substrate buer at
37 C (Tris-HCl 50 mM, CaCl2 5 mM, NaN3 0.02%, pH 7.5). After staining and destaining the gels,
MMP gelatinolytic activity was detected as clear bands on a blue background after staining the gels
with Coomassie brilliant blue R250. Clear bands were quantified by densitometric scanning (UVBand,
Eppendorf, Italy).
2.12. Wound Healing Assay
Cell migration of tenocytes was analyzed by a wound healing assay [23] in CT-, MD- or COL-coated
6-well multi-well plates. The “scratch” was obtained in confluent tenocytes using a p 200 pipet tip.
After washing with DMEM to remove cell debris, multi-well plates were incubated in serum-free
DMEM at 37 C and observed under an inverted microscope. Migration was evaluated by measuring
the closure of the wound at 0 and 24 h.
Digital images were captured by a digital camera at dierent time points (0 and 24 h), and the size
of the “scratch” was measured to assess the migration potential, expressed as a % compared with the
0 h time point.

2.13. Statistical Analysis
Data were obtained from two replicate experiments for each of the subjects-derived cell lines
cultured in duplicate and were expressed as mean  standard deviation (SD). Statistical analysis was
performed by t-test to compare untreated vs. CyB-treated samples cultured on the same substrate
and ANOVA followed by Tukey’s multiple comparisons test using GraphPad Prism v 5.0 software
(GraphPad Software Inc., San Diego, CA 92108, USA). Dierences associated with p values lower than
5% were considered statistically significant.

3. Results
   3.1. Analysis and Characterization of the Coating
   The presence and the characteristics of the coating obtained using MD or COL were analyzed
   by scanning electron microscopy (SEM). We did not detect collagen fibrils in Petri dishes coated
   with MD or COL (Figure 3), compared to CT. As a control, we compared MD- and COL-coated Petri
   dishes with a commercially available Petri dish coated with Type I collagen (CELLCOAT Type I
   Collagen—Greiner bio-one cod.628950), in which the presence of the coating resulted undetectable at
   SEM as well (Figure 3).

To understand if the coating influences cell alignment, cells were grown on 12-mm diameter
coverslips coated with MD: SEM analysis confirmed that collagen fibrils are undetectable and that the
coating does not induce cell alignment. Indeed, cells were arranged without any preferential direction
(Figure 3).
Since the morphological analysis was not able to reveal the presence of the coating, we analyzed
coated specimens by Raman spectroscopy. As described in the Materials and Methods section, MD and
COL were deposited on a calcium fluoride slide and dried overnight [24]. The microscopic analysis
revealed two separated regions in MD, characterized by a crystal formation and a fibrillary dispersion
(Figure 4a–c). The Raman analysis was focused on these two regions (Figure 4d,e).

The crystal part presents the typical sharp peaks of crystal structures, with peaks attributable
to the characteristic signals of riboflavin (750, 1345, 1410 cm􀀀1) and ascorbic acid (605 and 632 cm􀀀1)
(Figure 4d), both present in the MD product [25,26]. The fibrillary part was mainly composed of
collagen due to the presence of characteristic peaks at 536, 858, 919, 1065, 1343, 1454 and 1674 cm􀀀1
(Figure 4e) [27].
The comparison between COL and the MD fibrillary part (Figure 4f) reveals common peaks at 500,
580, 829, 1248, 1430 and 1650 cm􀀀1 with a partial dierence in the global spectral shape. A potential
explanation can be found in the presence of MD in dissolved salts in the product solution that can alter
and modify the conformation, interaction with the environment and structure of the protein. As a
consequence, the detected Raman signal is altered, but still consistent with the presence of collagen.
The potential attribution of the main peaks (Figure 4f) is reported in Table 1. The main dierences
between COL and the MD fibrillary part are highlighted by the subtraction spectrum in Figure 4g.
The alteration of peaks at 1235 and 1665 cm􀀀1 due to the Amide I and III bands and at 1443 cm􀀀1 due
to the CH3 skeletal deformation indicates a change in the collagen fundamental structure of MD.

3.2. Cell Morphology
Before analyzing the eect of MD and COL on tenocytes, we first observed the actin cytoskeleton
in cells treated with dierent doses of CyB. Tenocytes possess long microfilaments mostly arranged
in longitudinal arrays parallel to the long axis of the cells. At the concentration of 10 M, CyB is
able to block the dynamic instability of the actin cytoskeleton in order to deprive tenocytes of the
mechanical stimulation mediated by actin microfilaments. At this concentration, filaments preserved
their integrity and their distribution, without any evident morphological modification and without
significantly damaging the mechanosensory apparatus. Higher doses strongly induce actin filaments
loss, becoming progressively more evident when increasing the dose (Figure 5a). Phase contrast
microscopy analysis revealed that cell morphology was unaected in cells grown on MD and COL,
compared to CT. However, when cells are treated with CyB, tenocytes cultured on MD and COL do
not change their morphology, while CT cells become less flattened and more rounded (Figure 5b),
suggesting that they are less attached to the substrate.

3.3. Expression of Genes and Proteins Related to Collagen Turnover
COL-I protein levels secreted by tenocytes in cell supernatants were analyzed by slot blot.
The statistical analysis using the t-test revealed a significantly increased COL-I secretion in cells
cultured on MD (p = 0.033) and a trend of increase in cells cultured on COL (p = 0.08), compared to CT.
CyB administration did not influence COL-I secretion by tenocytes (Figure 6a). The AVOVA p-value
was statistically significant (p = 0.0056) and the post-test showed a significant increase in COL-I in
COL vs. CT (p = 0.041), in COL vs. CT+CyB (p = 0.011) and in COL+CyB vs. CT+CyB (p = 0.022).

Collagen maturation was analyzed by assessing the mRNA levels for LH2b, involved in the
cross-linking of newly synthetized collagen, by real-time PCR. LH2b mRNA levels were significantly
higher in tenocytes cultured on MD and COL (p = 0.039 and 0.020, respectively), compared to CT.
CyB administration reduced LH2b gene expression in cells cultured on MD and COL (p = 0.053
for COL vs. COL+CyB), but not in CT (Figure 6b): this finding suggests that LH2b up-regulation
induced by the coating is triggered by a mechanical stimulation mediated by the actin cytoskeleton.
The ANOVA p value was 0.0095 and the post-test confirmed the induction of LH2b in COL compared
with CT (p = 0.025) and revealed a significant decrease in COL+CyB vs. COL (p=0.025).
Interstitial collagen degradation is driven by MMP-1. Slot blot analysis of MMP-1 levels in cell
culture supernatants revealed that this collagenase remained unaected in tenocytes cultured on MD
and COL, compared to CT, as well as after CyB administration (Figure 7a,c). A similar pattern of
expression was observed for MMP-2 gelatinolytic activity, assessed by SDS-zymography (Figure 7b,d).
A similar pattern was also observed for TIMP-1, the main inhibitor of MMP-1, analyzed at the gene
expression level by real-time PCR. TIMP-1 mRNA levels revealed wide interindividual dierences and
were similarly modified by CyB in all the experimental groups (Figure 7e).

3.4. Cytoskeleton Arrangement and Vinculin Expression in Focal Adhesions
In order to understand whether MD or COL may represent a mechanical stimulation able to
influence the ability of tenocytes to form focal adhesions, we analyzed the expression of VNC,
a key protein involved in the formation of the adhesion plaque, by morphological and molecular
methods. Western blot analysis showed that VNC protein levels were significantly up-regulated in
cells grown on MD (MD vs. CT, p = 0.033) and tended to increase also in cells cultured on COL. In this
experimental group, VNC was significantly decreased by CyB treatment (COL vs. COL+CyB, p = 0.040)
(Figure 8a,b). The eects of the presence of the scaold and of CyB administration were more evident
using morphological analysis by immunofluorescence. Indeed, VNC immunoreactivity, localized at
the extremities of actin filaments in correspondence with focal adhesion formation on the substrate,
was found to be stronger and wider in tenocytes grown on MD and COL, compared to CT (Figure 8c).
After CyB administration, the VNC immunofluorescence signal and the regions corresponding to the
presence of the focal adhesion seemed less evident and smaller only in cells grown on MD and COL,
but not in CT, becoming similar to CT (Figure 8c, arrows).

3.5. Wound Healing Assay
Cell migration, playing a key role during tendon healing, was assessed by a wound healing assay
in tenocytes grown on CT, MD and COL with or without CyB administration. The quantification of the
scratch size revealed that cell migration is significantly increased in tenocytes cultured on MD and
COL, compared to CT (p = 0.023 and p = 0.032, respectively). Conversely, cell migration remained
unaected by CyB treatment in CT, but was strongly reduced in MD (MD vs. MD+CyB, p = 0.040) and,
although not statistically significant, in COL tenocytes (COL vs. COL+CyB, p = 0.07) (Figure 9a,b).
The ANOVA p value was 0.001 and the post-test confirmed the increased migration induced by COL
compared to CT (p = 0.015) and revealed a significant increase in the migration of cells cultured on MD
or COL compared to CT+CyB (p = 0.009 and p = 0.001, respectively).
3.6. Expression of FAK, PAX and YAP/TAZ as Mechanosensors
To understand if the scaold containing MD and COL aects tenocytes biology by a mechanical
stimulation, the expression of key proteins playing a role as mechanosensors was analyzed.
FAK and PAX are proteins in the adhesion plaque that also act as mechanosensors. Their mRNA
levels tended to be up-regulated in tenocytes cultured on MD and COL compared to CT, although not
reaching the statistical significance (p = 0.09). CyB treatment did not aect FAK in CT but had an
impact on its expression in cells cultured on MD (p = 0.09) and COL, determining its reduction
(Figure 10a). The ANOVA revealed that FAK mRNA levels are up-regulated in MD vs. CT (p = 0.017)
and vs. CT+CyB (p = 0.020) and that they are decreased in MD vs. MD+CyB (p = 0.013) and COL+CyB
(p = 0.018). A similar pattern was observed for PAX: its expression was higher in MD (p = 0.075) and
COL, compared with CT, and was reduced by CyB only in cells cultured on the scaold (p = 0.07 forMD
vs. MD+CyB and p < 0.05 for COL vs. COL+CyB), whilst it remained unchanged in CT (Figure 10b).
The analysis of PAX gene expression by ANOVA showed that its expression was significantly increased
in MD vs. CT and vs. CT+CyB (p = 0.0059 and p = 0.052, respectively), while it was reduced in
MD+CyB (p = 0.003) and COL+CyB (p = 0.007) compared to MD.
Cells 2020, 9, 2641 13 of 20
Yes-associated protein (YAP) and transcriptional co-activator with PDZ-binding motif (TAZ) are
mechanosensors whose activity is regulated by phosphorylation, leading to protein inactivation and
cytoplasmic translocation. YAP/TAZ were first analyzed byWestern blot using antibodies to detect
both the unphosphorylated (active) and phosphorylated (inactive) proteins. YAP and p-YAP resulted
in being similarly expressed in cell lysates obtained from CT, MD and COL tenocytes, although a
significant down-regulation was observed after CyB administration in cells cultured on MD (p = 0.044)
(Figure 10c). p-YAP resulted in being similar in all the experimental conditions (Figure 10d) as well
as the YAP/p-YAP ratio (Figure 10e). A similar pattern was observed for TAZ and p-TAZ (data not
shown).
In order to understand whether MD or COL were able to trigger a mechanical stimulation in
tenocytes, YAP/TAZ activation induced by the scaold was investigated by analyzing their localization
by immunofluorescence analysis. YAP/TAZ were expressed both in nuclei and the cytoplasm. We
observed a stronger nuclear immunoreactivity in tenocytes cultured on MD and COL, compared to
CT. In CT, CyB did not significantly modify this pattern of expression, whilst in tenocytes cultured on
MD and COL, CyB strongly increased the number of nuclei having a less intense YAP/TAZ labeling
(Figure 11): this finding suggests that mechanical stimulus deprivation following CyB administration
inactivated YAP/TAZ and induced their translocation from the nucleus to the cytoplasm.

4. Discussion
   The mechanobiology of tenocytes is vital to preserve tendon homeostasis [28–31]. Tenocytes are
   able to sense mechanical stimuli imposed on tendons during mechanical loading and can adapt their
   metabolism in an anabolic or catabolic manner in order to remodel the ECM according to the applied
   loads [32–34]. Therefore, tenocytes are responsible for tendon mechanical adaptation: they convert
   mechanical stimuli into biochemical signals that ultimately influence tendon adaptive physiological or
   pathological changes, thus aecting its biomechanical properties [13,15,16]. In fact, it was reported that
   physiological mechanical loading increases collagen synthesis [14,35], while reduced loading leads to
   MMP-1 up-regulation [36].
   Tensile loading acting on tendons is transduced into intracellular biochemical responses by
   various sensors and pathways, and the propagation of extracellular-generated forces rely on the
   actin cytoskeleton [37]. Actin filaments mediate the modification and deformation of the ECM and
   contribute to the propagation of mechanical stimulation to the nucleus, where gene expression for
   ECM components can be accordingly aected [38]. It has been demonstrated that the deprivation
   of mechanical stimulation on tendons mediated by the actin cytoskeleton can be obtained by CyB
   treatment [36]. Therefore, in order to understand if MD acts as a mechanical scaold, we utilized
   CyB to analyze if the eects elicited by MD or COL on tenocytes behavior are aected by mechanical
   loading deprivation.
   For this purpose, we first analyzed the scaold containing MD and COL at SEM to evaluate if the
   substrate arrangement could influence cell alignment. The observation at SEM of Petri dishes coated
   with MD or COL did not reveal the presence of collagen fibrils, possibly due to a fragmentation into
   small fragments of the collagen contained in the device. As a consequence, when cultured on the
   scaold, cells were not influenced in their arrangement and grew without any specific distribution.
   To support our findings, a further SEM analysis conducted on a commercial Petri dish coated with type
   I collagen confirmed that collagen fibrils are undetectable. Since, in our previous study, we showed
   that MD was able to modify some biological activities of tenocytes [19], we tried to demonstrate the
   presence of the scaold using a dierent approach such as Raman spectroscopy. Using this technique,
   we were able to assess the presence of mainly type I collagen in MD prepared to culture tenocytes.
   After demonstrating the presence of the scaold, we investigated collagen turnover, since COL-I is
   the main component of the tendon ECM. Its content is regulated by a finely balanced turnover controlled
   by tenocytes acting at the level of collagen synthesis, maturation and degradation. Collagen turnover,
   therefore, plays a key role in determining the tendon ability to resist mechanical forces and repair in
   response to injury [9]. We previously demonstrated thatMDfavors COL-I secretion [19], suggesting that
   this medical compound is able to trigger the anabolic phenotype of tenocytes. In the present study,
   our results confirm the increase in COL-I protein levels in the supernatant of tenocytes cultured on
   MD and COL, compared to CT. Since CyB administration had no eect on collagen expression in
   all experimental groups, there is not a clear demonstration that the eect of the scaold on COL-I
   expression is mechanically induced and mediated by the actin cytoskeleton.
   Maturation of newly synthesized collagen is needed to provide collagen fibril stabilization and
   tendon tensile strength and is obtained by the cross-linking of newly secreted collagen by enzymes such
   as LH2b [39,40]. Our results show that LH2b is up-regulated by MD, and also by COL, in tenocytes
   cultured for 48 h, as previously demonstrated [19]. Interestingly, this eect was lost after CyB
   administration only in tenocytes cultured on MD and COL, but not in CT, pointing to a mechanical
   mechanism exerted by MD to trigger collagen maturation to improve collagen stability.
   Collagen turnover pathways include collagen breakdown played by MMP-1, which cleaves the
   intact collagen triple helix, followed by other proteases such as MMP-2 [41,42]. The key role of MMP-1
   in tendon ECM homeostasis is based on the previously demonstrated inverse correlation between
   MMP-1 expression at the gene and protein levels and the amplitude of tensile mechanical load acting
   on tendons. In fact, low levels of MMP-1 induced by mechanical loading are related to a more stable
   tendon structure [36]. Here, we show that MMP-1 and MMP-2 levels are not aected by MD and
   Cells 2020, 9, 2641 16 of 20
   COL, and they remain unchanged by CyB administration. When investigating collagen degradation,
   TIMPs expression should be also analyzed. TIMP-1 is the main inhibitor of MMP-1, binding MMP-1 in
   a 1:1 stoichiometric ratio and inhibiting its activation and activity [43,44]. TIMP-1 mRNA levels slightly
   increased in tenocytes cultured for 48 h on MD and COL, compared to CT, as previously reported [19],
   and were reduced after CyB administration in all the considered experimental groups. This finding
   suggests that, in our experimental conditions, TIMP-1 levels are not under specific mechanical control
   mediated by the actin cytoskeleton. Overall, collagen turnover mechanisms involving the activity of
   MMP-1, MMP-2 and TIMP-1 seem to be unaected by CyB.
   ECM remodeling and homeostasis are influenced by mechanical stimuli acting on tendons and
   tenocytes are mechanoresponsive cells: they play a key role as the eectors since they are able to sense
   mechanical signals and convert them into biological responses [45,46]. This activity of tenocytes is
   based on their actin microfilaments that represent a mechanotransduction system allowing to adapt
   tenocyte metabolism in response to dierent mechanical forces acting on tendons [36]. CyB is known
   to modify the dynamic instability of actin filaments. However, as shown in Figure 8, the dose of CyB
   used in this study did not injure microfilaments and tenocytes preserved their structural integrity.
   The actin cytoskeleton also plays a key role during cell migration. Since tenocytes migration is
   needed during tendon healing [47], we investigated, by a wound healing assay, if MD and COL aect
   cell migration and if their eect relies on a mechanoresponsive mechanism influenced by CyB treatment.
   We found that MD favors cell migration, as previously reported [19], as well as COL, confirming that
   the therapeutic activity of this medical device could be related to this eect. To demonstrate that
   MD-induced cell migration is triggered by a mechanotransduction system, the wound area was
   measured after CyB administration. Interestingly, CyB was able to decrease cell migration in tenocytes
   cultured on MD and COL, but not in CT, strongly suggesting that the stimulation of cell migration
   induced by MD is mediated by a mechanical eect.
   During the dynamic process of cell migration, cells undergo a repeated cycle of attachment to the
   ECM and subsequent detachment of the cell from the matrix. Transmembrane proteins, the integrins,
   mediate the attachment of tenocytes to the ECM and bridge the inside and outside of the cells. To do
   this, they link their cytoplasmic domain to the focal adhesion complexes at the leading edge of the cell,
   including many dierent proteins such as VNC, a cytoplasmic actin-binding protein enriched in focal
   adhesions [48–50]. Interestingly, the presence of VNC at adhesion complexes is force-dependent [50].
   Western blot analysis of VNC revealed some significant modifications induced by the medical device
   before and after CyB treatment. However, more interesting findings were obtained by morphological
   analysis using immunofluorescence, which revealed some qualitative dierences in cells cultured
   on MD and COL, compared to CT. In fact, VNC immunoreactivity detectable at the extremity of
   microfilaments and the size of focal adhesions containing VNC seem more evident and larger in cells
   grown on the medical device, compared to CT. This observation suggests the hypothesis that VNC
   expression can be aected by MD and COL, and that the medical devices could improve the attachment
   of tenocytes to ECM components and, therefore, their ability to form more ecient focal adhesions to
   favor cell migration. This hypothesis is supported by the observation that, after CyB administration,
   focal adhesions of cells cultured onMDand COL are similar to those observed in CT. Accordingly, it was
   reported that VNC recruitment is enhanced when tension increases, while, when tension decreases,
   focal adhesions are disassembled in response to decreased tension [50]. Moreover, the analysis with
   the phase contrast microscope revealed that cell morphology was similar in tenocytes grown on CT,
   MD and COL. By contrast, CyB induced a less flattened morphology in CT, confirming the hypothesis
   that the medical device is able to favor cell adhesion and thus cell migration.
   To finally demonstrate that MD aects tenocyte behavior representing a mechanical stimulus
   acting on mechanotransduction mechanisms, we analyzed the eect of the medical device on the
   expression of key mechanosensors such as FAK, PAX and YAP/TAZ. FAK and PAX are components of
   the adhesion plaque complex. They are involved in the formation of focal adhesions needed for cell
   migration but they also play a key role acting as mechanosensors [51–53]. Our data show that FAK
   Cells 2020, 9, 2641 17 of 20
   and PAX gene expression is strongly influenced by MD as well as by COL, compared to CT. When CyB
   is added to the cell culture medium for 48 h, FAK and PAX mRNA levels are down-regulated only
   in tenocytes grown on MD and COL, and not in CT. This finding suggests that their induction is
   dependent on the mechanical stimulus exerted by the medical device used as a scaold. Moreover,
   this eect is lost when the transmission of the mechanical stimulus on tenocytes is blocked when cells
   are deprived of their mechanotransduction apparatus. To strengthen this hypothesis, we analyzed
   the expression of the transcriptional regulators YAP/TAZ, which are regulated by mechanical inputs
   in a variety of cellular settings, thus impacting many dierent cell activities [51]. YAP and TAZ
   act as mechanosensors primarily regulated by the substrate on which cells adhere, which, in turn,
   influences YAP/TAZ activity stimulating the actin cytoskeleton. The integrity of microfilaments is
   pivotal on YAP/TAZ activity. In fact, treatment of cells with Latrunculin A, an inhibitor of actin
   polymerization, results in phosphorylation of YAP and cytosolic localization of YAP/TAZ [51]. In this
   study, we used CyB to inhibit actin polymerization and to block its dynamic instability in order to
   analyze YAP/TAZ expression in tenocytes cultured on MD and COL, compared to CT, to demonstrate
   that the medical device represents a mechanical stimulus to aect cell behavior.
   Western blot analysis of YAP/TAZ did not reveal important dierences as well as in the YAP/p-YAP
   ratio. However, our data suggest that MD and COL represent a mechanical input for tenocytes since
   immunofluorescence analysis demonstrated that YAP/TAZ expression is more nuclear in cells cultured
   on MD and COL, compared to CT. This suggestion is further supported by the observation that after
   CyB administration, depriving cells of the mechanical input mediated by the cytoskeleton, YAP/TAZ
   immunoreactivity becomes less nuclear and more cytoplasmic only in cells grown on MD and COL,
   and not in CT. This suggestion is consistent with previous studies demonstrating that, since YAP/TAZ
   serve as mechanotransducers and mechanosensors, their subcellular localization and activity are tightly
   regulated by cell substrate rigidity and tensile inputs from the ECM [53–55], and that cytoskeletal
   tension is required for YAP/TAZ nuclear localization [53].
5. Conclusions
   Considered as a whole, these in vitro findings suggest that MD and COL trigger similar responses
   in tenocytes and that their eect on tenocytes behavior represents a mechanical input involving the
   mechanotransduction machinery. In particular, we showed that MD-Tissue influences some tenocytes
   activity involved in ECM homeostasis and improves focal adhesion formation and migration ability.
   Overall, we confirm that MD-Tissue, acting as a mechanical scaold, could be an eective medical
   device used as a novel therapeutic, regenerative and rehabilitative approach to favor tendon healing
   in tendinopathies.
   Author Contributions: Conceptualization, N.G.; methodology, N.G., P.S., C.C., E.V.; investigation, F.R., P.S., C.C.,
   M.B., A.M., E.V., M.S., N.G.; data curation, N.G.; writing—original draft preparation, N.G..; writing—review and
   editing, F.R., P.S., C.C., M.B., A.M., E.V., M.S., N.G; funding acquisition, N.G. and F.R. All authors have read and
   agreed to the published version of the manuscript.
   Funding: This study was partially supported by Guna S.p.a. The funder had no role in the design or conduct of
   the study, in analysis and interpretation of data or in the preparation of the manuscript.
   Acknowledgments: We would like to thank Vincenzo Conte (Department of Biomedical Sciences for Health,
   Università degli Studi di Milano) for his help in electron microscopy analysis.
   Conflicts of Interest: The authors declare that the manuscript is free of conflict of interest. This study was
   partially supported by Guna S.p.a. The sponsor had no role in the design or conduct of the study, in analysis and
   interpretation of data, in preparation of the manuscript or in the decision to publish the results of the study.